Variant-aware Cas-OFFinder

Variant-aware Cas-OFFinder is a variant-aware potential off-target sites identifying tool based on Cas-OFFinder. Using a reference genome alone to search potential off-target sites has many drawbacks since it may not contain individual variants, making it challenging for therapeutic applications. VarCas-OFFinder considers individual variants along with reference genomes to search potential off-target sites.

Quick Start to use the web interface

1. Navigate to https://rgetoolkit.com/

2. Download the provided Sample VCF file

3. Default settings:

   • Target Genome: Homo sapiens (GRCh38/hg38)

   • PAM Type: SpCas9 from Streptococcus pyogenes: 5’-NRG-3’

   • Query Sequence: CAGCAACTCCAGGGGGCCGC

   • Mismatches: 3

4. Click Submit to process the sample file.

5. For custom analysis, upload your phased single-sample VCF file.

Contents

• Quick Start
  • Quick Start to use the web interface
  • Quick Start to use the CLI
• Tutorial
  • Tool usage guide
    • A step-by-step guide
  • Requirements
    • Supported File Format
    • Required Tools for CLI and Local Deployment
  • Best Practices
    • Best Practices for Optimizing Performance with Large VCF Files
  • How to use the web interface
    • Common error messages and solutions
  • How to use the command-line interface
  • How to deploy Source Code on local machines
    • Docker compose tutorial
• Version History
  • 1.x Series
    • 1.0.1
    • 1.0.0