Variant-aware Cas-OFFinder ========================== **Variant-aware Cas-OFFinder** is a variant-aware potential off-target sites identifying tool based on Cas-OFFinder. Using a reference genome alone to search potential off-target sites has many drawbacks since it may not contain individual variants, making it challenging for therapeutic applications. VarCas-OFFinder considers individual variants along with reference genomes to search potential off-target sites. Quick Start to use the web interface ------------------------------------ 1. Navigate to https://rgetoolkit.com/ 2. Download the provided **Sample VCF file** 3. Default settings: - Target Genome: Homo sapiens (GRCh38/hg38) - PAM Type: SpCas9 from Streptococcus pyogenes: 5'-NRG-3' - Query Sequence: CAGCAACTCCAGGGGGCCGC - Mismatches: 3 4. Click Submit to process the sample file. 5. For custom analysis, upload your phased single-sample VCF file. .. toctree:: :maxdepth: 4 :caption: Contents quickstart userguide version_history