Quick Start

Quick Start to use the web interface

  1. Navigate to https://rgetoolkit.com/

  2. Download the provided Sample VCF file

  3. Default settings:

    • Target Genome: Homo sapiens (GRCh38/hg38)

    • PAM Type: SpCas9 from Streptococcus pyogenes: 5’-NRG-3’

    • Query Sequence: CAGCAACTCCAGGGGGCCGC

    • Mismatches: 3

  4. Click Submit to process the sample file.

  5. For custom analysis, upload your phased single-sample VCF file.

  6. For faster execution, upload a VCF file containing a few chromosomes, like chr1 and chr2, by filtering them using the command:

    bcftools view -r chr6,chr10 NA12878.vcf.gz -o Output.vcf.gz

Quick Start to use the CLI

Create a conda environment

conda create -n varcasoffinder

Activate the conda environment:

conda activate varcasoffinder

Install all dependencies

pip install -r requirements.txt

Then for help, run:

./vcf-cas-offinder.py -h
CLI help message